His-ALN was purified from the soluble cell fraction using TALON M

His-ALN was purified from the soluble cell fraction using TALON Metal Affinity Resin, as described (Clontech). His-ALN was eluted from the resin with 50 mM imidazole, 20 mM Tris-HCl, 100 mM NaCl, pH 8.0 (elution buffer). Total protein concentration was determined using Bradford Protein Assay Reagent (Bio-Rad). For some experiments ALN was amplified from ATCC 9345 DNA using the primers ALN26-F (GCCGCCGCTAGCGTTGACGCTTCAACACAAACCGATCC)

and ALN-R (GCCGCCCTCGAGTCACTCGCTATGAACGATGTTCTTG), cloned into expression vector pET28a (Novagen) using NheI and XhoI sites (underlined), and confirmed by sequencing. The plo gene encoding PLO was amplified from T. pyogenes ATCC 49698 DNA using the primers PYO28-F (GCCGCCCATATGGCCGGATTGGGAAACAGTTCG) and PYO-R (GCCGCCCTCGAGCTAGGATTTGACATTTTCCTC), cloned into pET28a using NdeI and XhoI sites (underlined), and LY2603618 cell line confirmed by sequencing. The ily gene encoding ILY was amplified from Streptococcus intermedius and cloned into pET28a as described [22]. Purification of the His-tagged CDCs was as previously MK-0457 described [22, 23]. SDS-PAGE and Western blotting Proteins were separated by electrophoresis in 10% (w/v) SDS-polyacrylamide gels and transferred to nitrocellulose [15]. Western blots were immunostained

using rabbit anti-His-ALN (prepared by immunization of a rabbit with His-ALN, Antibodies Inc., Davis, CA) and rabbit anti-goat IgG(H+L)-peroxidase conjugate (KPL), as the primary and secondary antibodies, respectively. Rabbit antiserum against PFO was kindly provided by Rodney K. Tweten, University of Oklahoma Health Sciences Center, OK. Hemolytic assays The hemolytic titers of His-ALN preparations were determined by incubation of two-fold serial dilutions of protein with an equal volume of 0.5% blood (Cleveland Scientific, Bath, OH) at 37°C for 1 h [14]. The hemolytic titer was the reciprocal of the highest dilution which resulted in 50% cell lysis, expressed as hemolytic units (HU) [14]. The specific activity of purified His-ALN was determined as HU/μg protein. Thiol activation was assessed by incubation of 5 HU His-ALN with 2% β-mercaptoethanol

for 10 min at room temperature, prior to performing a hemolytic assay with human blood (Cleveland Scientific). Cholesterol inhibition was assessed by incubation of 5 HU His-ALN with 0.01-1 μM cholesterol for 30 DCLK1 min at room temperature with shaking, prior to performing a hemolytic assay with human blood. Cholesterol was diluted in absolute ethanol and an equal volume of ethanol was used as the cholesterol-free control. His-tagged perfringolysin O (PFO) [24] and His-tagged PLO [14] were used as controls in the various hemolytic assays. For some experiments hemolysis assays were performed as described [22, 23]. Epithelial cell cytotoxicity The epithelial cell cytotoxicity of His-ALN was determined using the CellTiter 96® Aqueous One Solution Cell Proliferation Assay (Promega). A549 (human lung, CCL-185), CHO (hamster ovary, CCL-61), HCT-8 (human colon, CCL-244), J774A.

Comments are closed.