It is appropriate now to consider completing the model of MMP functions and magnetosome formation

that was proposed previously PD0325901 [14, 32]. Conclusions The results of the present study show that the MamX protein plays an important role in controlling magnetosome size, maturation, and crystal form. Previous studies have shown that a single gene deletion in mamXY and knock-out of the entire operon result in very similar phenotypic characteristics. The MamXY proteins may therefore have redundant functions involved in magnetosome synthesis. These findings are important for further elucidation of the biomineralization process in MTB. Methods Bacterial strains and growth conditions The bacterial strains and plasmids used are listed in Table 3. Escherichia coli strains were cultured in Luria broth (LB) at 37°C. M. gryphiswaldense and its mutant strains were cultured in liquid optimized flask medium (OFM) at 30°C [33]. Sterile ferric

citrate was added to OFM as an iron source after autoclaving. For conjugation, M. gryphiswaldense was cultured on a selection medium plate [34]. The antibiotics used were as follows: for E. coli, 50 μg/ml chloromycetin (Cm), 20 μg/ml gentamicin (Gm), 12.5 μg/ml tetracycline (Tc); for M. gryphiswaldense, the same antibiotics at concentrations of 5 μg/ml. The biomass of MSR-1 cells during culture was measured in terms of OD565. The magnetism of cells was measured as Cmag value as described previously [20]. Table 3 Strains and plasmids used Doramapimod order in this study Strains and plasmids Description Source or reference Strains     M. gryphiswaldense MSR-1 wild-type, Nxr DSM6361 M. gryphiswaldense MSR-1 ΔmamX mamX deficient mutant, Nxr Gmr present study M. gryphiswaldense MSR-1 CmamX complementation of ΔmamX, NxrGmrTcr present study E. coli DH5α endA1

hsdR17 (r- m+) supE44 thi-1 recA1 gyrA (NalR) recA1 Δ (lacZYA-argF)U169 deoR [Ø80ΔdlacZ ΔM15] [35] E. coli S17-1 thi endA recA hsdR with RP4-2-Tc::Mu-Km::Tn7 integrated in chromosome, Smr [36] Plasmids     pUCGm pUC1918 carrying the aacC1 gene, Gmr [37] TPX-0005 solubility dmso pSUP202 suicide vector for M. gryphiswaldense MSR-1, selleck products CmrTcr Ampr [38] pSUPpX2 pSUP202 derivative for mamX deletion, GmrCmrAmpr present study pRK415 Cloning vector, pRK290 derivative, Tcr [39] pRK415X pRK415 derivative for mamX expression, Tcr present study Construction of the mamX deletion mutant and complemented strains The mamX deletion mutant was constructed by conjugation and subsequent homologous recombination in MSR-1. (i) The 5′ flank (1003 bp; primers: mamX-5F, CGCGGATCCAT GTTGATGAACTTTGTCAA; mamX-5R,CGAGCTCGGGAGTTCGACTGTGGTCAA3) and 3′ flank (1043 bp; primers: mamX-3F, CGAGCTCGTGCCCTGCGTGACGACCAT; mamX-3R, ACGCGTCGACAACATTCCGAGCCAGATATA) of the mamX gene in the MSR-1 genome were amplified by PCR (restriction sites are underlined). The aacC1 gene that confers Gm resistance (Gmr) was digested from plasmid pUCGm by SacI sites.